1.5M ratings
277k ratings

See, that’s what the app is perfect for.

Sounds perfect Wahhhh, I don’t wanna
thesaurus-robot
thehighpriestofreverseracism

Friendly reminder that the intro to Lion King….the non english bits leading up to the “circle of life” is not random yelling in *Africa voice* it is an actual language, Zulu, spoken by 10 million people, it is the most widely spoken language (out of 11) in the country of South Africa (1 out of the 54 countries in the continent of Africa, the continent home  to somewhere between 1500-2000 languages and around 3000 distinct ethnic groups)

this isn’t to say that you have to friggin learn the language to sing along with a disney film, it just means that you should be mindful, respectful, appreciative and respectful. don’t be yelling out whatever noise comes in to your head when you hear it

melancholic-pie

Ok but someone knows what does this say?

thehighpriestofreverseracism

The lyrics before the english comes in…in “circle of life”

Nants ingonyama bagithi baba [Here comes a lion, Father]
Sithi uhm ingonyama [Oh yes, it’s a lion]

Nants ingonyama bagithi baba [Here comes a lion, Father]
Sithi uhm ingonyama [Oh yes, it’s a lion]
Ingonyama [It’s a lion]

Siyo Nqoba [We’re going to conquer]

Ingonyama Ingonyama nengw’ enamabala [A lion and a leopard come to this open place] (repeats)

[queue English lyrics]


I would like to further add that language has there own cultural nuances so something that can sound extremely meaningful in one languages may not sound as majestic when translated to another (I know this as someone who has an understanding of 5 languages and speaks 3 of them fluently) so if you are thinking “oh it ain’t that deep they are just yelling: the lion is coming!” dial it back

saintbanglesthegazelle

Worth noting that “lion” and especially the word Ingonyama is a very respectful word to talk about a Zulu king, especially in praise. It’s so heavily associated with royalty in isiZulu that a different word is used for an animal lion - Ibhubesi. This isn’t just announcing the arrival of an animal, it’s celebrating the arrival (or coronation?) of the king

thehighpriestofreverseracism

/\ Whoop, I didn’t know this

beyoncescock

This is so informative thank you so much

thesaurus-robot

beyoncescock :

thehighpriestofreverseracism :

saintbanglesthegazelle :

thehighpriestofreverseracism :

depressive - Indo-Hittite :

thehighpriestofreverseracism :

warm experience that the musical passage to soul King… . the non a people bits up awake to the “ Rohypnol of organic phenomenon ” is not stochastic noisy inward * continent exponent * it is associate current word , Nguni , voiced away large integer cardinal make full , it is the well-nigh wide voiced module ( outgoing of large integer ) successful the people of cardinal compass point continent ( cardinal come out of the cardinal countries linear unit the landmass of continent , the continent come back to location ‘tween 1500 - 2000 languages and or so 3000 clear social groups )

this isn’t to impart that you change to friggin watch the communication to let loose on with fat-soluble vitamin movie maker photographic material , it but norm that you should metal reminiscent of , reverent , discriminating and reverent . don’t equal vociferation outgoing some vociferation comes metal to your source once you rivet it

American state only causal agency knows what does this speculate ?

The lyrics in front the spin comes in…in “ junction of time ”

Nants ingonyama bagithi cake [Here comes fat-soluble vitamin soul , Father]
Sithi uhm ingonyama [Oh affirmative , it’s purine lion]

Nants ingonyama bagithi cake [Here comes purine planetary house , Father]
Sithi uhm ingonyama [Oh affirmative , it’s alphabetic character lion]
Ingonyama [It’s blood type lion]

Siyo Nqoba [We’re exploit to conquer]

Ingonyama Ingonyama nengw’ enamabala [A famous person and current unit pelt come up to this unlawful place] ( repeats )

[queue arts lyrics]


cardinal would same to far make that textual matter has thither possess mental object nuances and then thing that container natural event highly important incoming unspecified languages Gregorian calendar month not sound off dominion superior once translated to other ( figure agnise this element causal agency UN agency has associate module of cardinal languages and speaks figure of them fluently ) solfa syllable if you square measure rational “ American state it ain’t that esoteric they square measure simply noisy : the famous person is timing ! ” control it skeletal structure

indefinite quantity noting that “ cat ” and specially the arcanum Ingonyama is alphabetic character precise reverent computer memory unit to scuttlebutt or so nucleotide African checker , specially metal value . It’s thusly hard joint with house incoming isiZulu that fat-soluble vitamin other hypostasis is old for associate physical famous person - Ibhubesi . This isn’t righteous announcing the action of associate being , it’s celebrating the traveller ( American state installation ? ) of the court card

/\ squall , figure didn’t cognise this

This is true informatory impart you indeed large indefinite amount



ThesaurusBot 0.3.0
Source: thehighpriestofreverseracism
sookqua
intranet

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

monkeysky

You got like six unique nucleotides so nice

deepspacepirate

OP is a virus from outer space

deepspacepirate

FUCK YOU OP

Source: anneuaidd